0
Add your answer:
Earn +20 pts
What faith did the isrealites believe in?
they believe in great faith
Where the code aatttgcgtcattgcctaaagct could possibly found?
I got this same question from my professor on my midterm... I believe its DNA... but dont have faith in me
Should people have faith?
yes you should have faith like faith in ur lord and stuff but if you dont have a religon then you dont really need faith well if u say u dont have faith in ur family
Is faith a religion?
Faith is what you believe in.
Why dont the baha'i faith believe in god?
On the contrary, members of the Baha'i Faith DO believe in God. The Baha'i Faith is the newest (1863) of the world's monotheistic religions, believing in one universal Creator. The Creator has been known by many names and each language has its own word for God: Gott, Dios, Allah, etc.
What makes Christians believe that God can do anything?
Faith. Faith is a gift from God, and a choice is made to embrace that faith. Christians choose, by faith, to believe that God can do anything.
How does your faith affect you?
my faith does not affect me in any way.coz i fully believe in my faith.
What is the difference between faith and science?
faith you believe things always believe science is truth and experiments chose faith over science!
What is the order of faith hope and believe?
hope, faith, belief.
Do solifidians believe in salvation through faith alone?
yes. they believe faith is practiced alone Latin roots: -Sol=alone -Fid=faith
The meaning of the name faith?
Faith is believing in what you do not see. The reward of faith, is to see what you believe.
What is the distinction between faith and religion?
Faith is what you believe in; religion is how you practice it.
