answersLogoWhite

0


Best Answer

Asexual reproduction.

User Avatar

Wiki User

13y ago
This answer is:
User Avatar
More answers
User Avatar

AnswerBot

7mo ago

Inbreeding is a breeding system that reduces genetic variation in a population. Inbreeding occurs when closely related individuals mate, leading to an increase in homozygosity and a decrease in genetic diversity within the population. This can result in an increased prevalence of genetic disorders and reduced fitness in the population.

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: Which breeding system reduces genetic variation in a population?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Continue Learning about Natural Sciences

How does genetic drift lead to a change in a populations gene pool?

Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s


Why a mutation that limits?

A mutation that limits genetic diversity can have negative consequences on a population because it reduces the ability of the population to adapt to environmental changes. This can make the population more vulnerable to diseases, genetic disorders, and other threats. Additionally, limited genetic diversity can reduce the overall health and resilience of a population over time.


Contrast gene flow with genetic drift?

Genetic drift is when a population experiences a decrease in variation and population size by chance due to the bottleneck or the founders' effect.For example, a volcanic eruption kills most of the flowers in a nearby area. This bottleneck effect reduces the variety of alleles and traits of the flowers by reducing their number.If a person brings some flowers from a garden to a new garden (the new area must be uninhabited by the same species), this founders' effect will start a new flower population from the migrated flowers' pollen with less variation than the original population, since the person had only brought some of the flowers.Gene flow is the movement of alleles between populations, which may make their gene pools more common.For example, if two areas trade birds by migration, gene flow is the switch of allele frequencies in each population, so each bird population loses a few alleles but gains a few alleles.Gene flow doesn't always involve an exchange in alleles. Gene flow can also occur when only one organism migrates from one population to another.


Why is selective breeding bad?

Selective breeding can lead to unintended consequences such as health problems or reduced genetic diversity, which can make a population more vulnerable to diseases or environmental changes. It can also perpetuate harmful traits or conditions if not done responsibly. Additionally, concerns arise when selective breeding is used unethically, such as in cases of exploitation or cruelty towards animals.


How does natural selection enhance or reduce the variability of a species?

Natural selection doesn't reduce variation. Variation is regulated by the rate of mutation.Natural selection reduces the chance of bad variation from being passed on and increases the chances for good variation to be passed on.

Related questions

Why genetic variation is a benefit to a population?

Genetic variation allows a population to adapt to a changing environment.


What effect does stabilizing selection have on variation in a population?

Stabilizing selection reduces variation in a population by favoring the average phenotype, while selecting against extreme phenotypes. This can lead to a decrease in genetic diversity within the population as individuals with extreme traits are less likely to survive and reproduce. Over time, stabilizing selection tends to maintain a stable, intermediate phenotype.


What is a genetic bottleneck and are humans affected by one?

A genetic bottleneck is a sharp reduction in the size of a population due to a natural disaster or human activities, resulting in reduced genetic diversity. Humans have experienced genetic bottlenecks in the past, such as the Out of Africa migration, which led to decreased genetic diversity.


Why genetic variation is of to benefit to a population?

Genetic variation provides a population with a better chance of survival in changing environments. It allows for adaptation to new challenges, such as diseases or climate changes, and increases the likelihood of some individuals passing on advantageous traits to their offspring. This diversity also helps to prevent inbreeding and reduces the risk of genetic disorders.


Genetic drift resulting from a disaster that drastically reduces population size is called?

The bottleneck effect.


Does genetic drift increase or decrease genetic variation in populations and why?

It is important to understand that each individual has different genes. Genes can be lost if an individual dies without reproducing. To answer your question: There are two type of effects caused by Genetic Drift. The founder effect happens when a few species inhabit a new territory. If only those species reproduce then there are less genes in the gene pool and that leads to less variation. This can happen if storms sweep birds to a previously uninhabited island. The other effect is the bottleneck effect. This happens if a disease or poaching drastically reduces the number of individuals in a population. Since there are less individuals who can reproduce there are not as many genes that can be passed down.


How does genetic drift lead to a change in a populations gene pool?

Genetic drift reduces variation in a population through allele loss, there are 2 situations of GD: a) Bottleneck effect: number of individuals is reduced significantly by a random event b) Founder effect: few individuals are separated and establish their own population both situations result in different allele frequency representations in new populations from their previous population`s


What does not add new alleles to a population gene pool?

Inbreeding reduces genetic diversity in a population and does not add new alleles to the gene pool. This can lead to an increased prevalence of harmful recessive traits.


Why a mutation that limits?

A mutation that limits genetic diversity can have negative consequences on a population because it reduces the ability of the population to adapt to environmental changes. This can make the population more vulnerable to diseases, genetic disorders, and other threats. Additionally, limited genetic diversity can reduce the overall health and resilience of a population over time.


What are the four genetic disorders?

-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT


What effect does a bottleneck have on the allele frequency of a population?

A bottleneck can lead to a significant reduction in the genetic diversity of a population, causing certain alleles to be lost and others to become more common. This can increase the frequency of rare alleles and result in genetic drift, potentially leading to an increase in genetic diseases or reduced fitness in the population.


Which type of natural selection tends to prevent evolution?

Stabilizing selection tends to prevent evolution as it favors the intermediate phenotype and reduces genetic variation in a population. This can lead to the maintenance of a stable population with limited change over time.