0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What sequence best represents the relationship between DNA and the traits of an organism?
DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.
What are the molecular units of protein molecules?
Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.
What organelle can be described as the blueprint to the creation of a protein?
The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.
What is the chemical structure and molecular formula of phytohaemagglutinin PHA?
Phytohaemagglutinin (PHA) is a protein found in certain plants, particularly in legumes like red kidney beans. It does not have a specific chemical structure or molecular formula like organic compounds, as it is a complex protein made up of numerous amino acids arranged in a specific sequence.
What is the term for one blueprint that tells a cell how to build a protein?
Jeebus-3
What Reads the blueprint and brings and inserts correct amino acid in making a protein sequence?
tRNA (transfer ribose nucleic acid.)
Which type of RNA is called the blueprint for construction of a protein?
Messenger RNA (mRNA) is the type of RNA that carries the genetic information from the DNA in the cell's nucleus to the ribosomes in the cytoplasm, where protein synthesis occurs. It is often referred to as the blueprint for constructing a protein because it carries the instructions for the sequence of amino acids that make up the protein.
What sequence best represents the relationship between DNA and the traits of an organism?
DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.
What are the molecular units of protein molecules?
Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.
What you would find in a gene?
a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).
What organelle can be described as the blueprint to the creation of a protein?
The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.
What is the role of DNA molecules in the synthesis of proteins?
DNA molecules serve as the genetic blueprint that contains the instructions for synthesizing proteins. The process begins with the DNA in the nucleus being transcribed into messenger RNA (mRNA). This mRNA then travels to the ribosomes in the cytoplasm where it is translated into a specific sequence of amino acids, which ultimately leads to the synthesis of proteins.
DNA is used as a blueprint to make this molecule?
Protein. DNA contains the genetic information necessary for building proteins through a process called protein synthesis.
Which structure determines the sequence of the building blocks in a protein?
DNA determines the sequence of the amino acids (building blocks) in a protein. The sequence of nitrogen bases in the DNA determines the sequence of amino acids in a protein.
What has the author Dongsheng Wang written?
Dongsheng Wang has written: 'Molecular cloning and nucleotide sequence of a Streptococcus mutans gene encoding biotin carboxyl carrier protein'
Where are gene sequence for protein in a prion?
there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.
What determines the amino acid sequence in a protein?
The sequence of amino acids in a protein is determined by the sequence of nucleotides in the mRNA, and this is determined by the sequence of nucleotide bases in the DNA.
