Tags Biology

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

What is the molecular sequence which is the blueprint for a protein?

Anonymous

∙ 10y ago

Updated: 10/16/2024

Still curious? Ask our experts.

Chat with our AI personalities

Coach

Success isn't just about winning—it's about vision, patience, and playing the long game.

Chat with Coach

Taiga

Every great hero faces trials, and you—yes, YOU—are no exception!

Chat with Taiga

Rafa

There's no fun in playing it safe. Why not try something a little unhinged?

Chat with Rafa

Add your answer:

Earn +20 pts

Q: What is the molecular sequence which is the blueprint for a protein?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

What sequence best represents the relationship between DNA and the traits of an organism?

DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.

What are the molecular units of protein molecules?

Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.

What organelle can be described as the blueprint to the creation of a protein?

The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.

What is the chemical structure and molecular formula of phytohaemagglutinin PHA?

Phytohaemagglutinin (PHA) is a protein found in certain plants, particularly in legumes like red kidney beans. It does not have a specific chemical structure or molecular formula like organic compounds, as it is a complex protein made up of numerous amino acids arranged in a specific sequence.

What is the term for one blueprint that tells a cell how to build a protein?

Jeebus-3

Trending Questions

How much does one oyster cost? Where in the atmosphere does fog occur? Where can you sell your binoculars? In what kinds of cells are chloroplast found? What size standard fuse should be used for a current of 315 amps? What is compromise reaction? Who makes satellites? How many us fl oz are in 1000 ml? How many egg cell does a female pig produce during ovulation period? Why does my brother has hazel green eyes and i have brown eyes? What brain injuries are most likely to be fatal? Why is a sample of magnesium fluoride have a strong attraction for each other? What does the body do with all the ATP cellular respiration does? What portion of the mantel is hot enough to begin melting rocks into magma? What are the four types of endocrine cell in pancreatic islets? Where is energy stored in living things? Bonding between elements in middle of periodic table tend to bewhat kind of chemical bonding? What type of animal is a predator? Is the transition metals react slowly? One inch equals how many centimeters?

Related Questions

What Reads the blueprint and brings and inserts correct amino acid in making a protein sequence?

tRNA (transfer ribose nucleic acid.)

Which type of RNA is called the blueprint for construction of a protein?

Messenger RNA (mRNA) is the type of RNA that carries the genetic information from the DNA in the cell's nucleus to the ribosomes in the cytoplasm, where protein synthesis occurs. It is often referred to as the blueprint for constructing a protein because it carries the instructions for the sequence of amino acids that make up the protein.

What sequence best represents the relationship between DNA and the traits of an organism?

DNA contains the instructions for building proteins, which determine an organism's traits. The sequence is: DNA → RNA → proteins → traits of an organism. This process is known as the central dogma of molecular biology.

What are the molecular units of protein molecules?

Protein molecules are made up of amino acid units, which are linked together in a specific sequence to form a polypeptide chain. The unique sequence of amino acids in a protein determines its structure and function.

What you would find in a gene?

a blueprint of one (sometimes of a few more) protein. It is a simple sequence of four units - A, T, G, C. So a gene looks like e.g. AGATGACTAGTCAAACCCCGGTCGACGCGCTACAT (lets say 10 times longer). This unique sequence of every gene is then translated to sequence of protein (protein = a chain, a sequence of aminoacids).Also, you find "promoter" and "terminator" sequences in each gene, required by gene-processing machinery (gene processing machinery is my own expression, it is not a terminus).

What organelle can be described as the blueprint to the creation of a protein?

The cell nucleus contains the "blueprints" for the production of protein. The "blueprints" are the DNA contained within the nucleus. DNA is often called the blueprint of life.

Which structure determines the sequence of the building blocks in a protein?

DNA determines the sequence of the amino acids (building blocks) in a protein. The sequence of nitrogen bases in the DNA determines the sequence of amino acids in a protein.

What is the role of DNA molecules in the synthesis of proteins?

DNA molecules serve as the genetic blueprint that contains the instructions for synthesizing proteins. The process begins with the DNA in the nucleus being transcribed into messenger RNA (mRNA). This mRNA then travels to the ribosomes in the cytoplasm where it is translated into a specific sequence of amino acids, which ultimately leads to the synthesis of proteins.

Where are gene sequence for protein in a prion?

there is no "protein in a prion", because prion is nothing but a protein. The gene sequence of this protein is just normal, with nothing special.

What determines the amino acid sequence in a protein?

The sequence of amino acids in a protein is determined by the sequence of nucleotides in the mRNA, and this is determined by the sequence of nucleotide bases in the DNA.

What is the specific expressed sequence of DNA that codes for a protein in this genetic sequence?

The specific expressed sequence of DNA that codes for a protein in this genetic sequence is called a gene.

What has the author Dongsheng Wang written?

Dongsheng Wang has written: 'Molecular cloning and nucleotide sequence of a Streptococcus mutans gene encoding biotin carboxyl carrier protein'

Still have questions?

imp

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.