0
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
In DNA, a complementary strand is the strand that matches and binds to the other side of the said DNA.
Each DNA base bonds with a certain one on the other strand. A binds to T, and C binds to G.
This means the complementary sequence of ATCGGTAC is TAGCCATG.
Add your answer:
Earn +20 pts
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What is the complementary DNA strand for atgtatcggatccatgtataa?
TACATAGCCTAGGTACATATT
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is the complementary DNA?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
What complementary strand of DNA would be produced from the DNA strand cgt ta?
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
Transcription makes a complementary strand of the DNA?
This Process Is Called DNA Transcription. *Apex*
What strand of DNA would be prod from the template strand of DNA shown below?
The complementary strand of DNA to the template strand TACGGCTA would be ATGCCGAT.
The manufacture of a strand of RNA complementary to a strand of DNA is termed?
Transcription
