0
Still curious? Ask our experts.
Chat with our AI personalities
Judy
Rene
SteveAdd your answer:
Earn +20 pts
How is genetic code used to make proteins?
There are twenty amino acids in proteins, three bases in a codon and three bases in an anti-codon newly known as an anti-sense codon. If the codons make up mRNA , then the anti-sense codons are found in the transfer RNAs. A triplet codon corresponds to an amino acid. Adenine pairs with Uracil, and Guanine Pairs with Cytosine. Let's say we had a mRNA strand like: AUACGUACGUACGUCACGUGAUGCUACACCUGACAUCCGAUCAUGAGUCGAUCAUGAUGA (oops, there's no more) The first codon is AUA. The anti-codon UAU, would attach to it. AUA corresponds to the amino acid Tyrosine. Then the next anti-codon GCA would attach to the second codon CGU. Arginine corresponds to the codon CGU. Tyrosine would join together with Arginine. The bond of the Tyrosine and its tRNA breaks. This is all done by a ribosome. The process continues until the chain is complete.
What name is assigned to augwhich stands for methionine in which all mRNA molecules start?
The start codon. The codon AUG is generally referred as the start codon because the translation of mRNA begins on AUG.
What is the codon that initiates transcription?
The codon that initiates transcription is the start codon "AUG", which also codes for the amino acid methionine.
What is the term for a 3-nucleotide sequence on mRNA that codes for an amino acid?
The term is "codon." Each codon corresponds to a specific amino acid or serves as a start or stop signal for protein synthesis.
What is the stop codon in most molecules of mRNA?
stop codon on mRNA
