Tags Science English Language

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Natural Sciences

What does state the key term mean?

Anonymous

∙ 11y ago

Updated: 9/23/2023

Definitions of key term:

1. A significant or descriptive word. 2. A word used as a reference point for finding other words or information.

So, to state the 'key term' of something means to simply point out the important points of it.

I hope that makes sense. :)

Wiki User

∙ 11y ago

Still curious? Ask our experts.

Chat with our AI personalities

Devin

I've poured enough drinks to know that people don't always want advice—they just want to talk.

Chat with Devin

Ross

Every question is just a happy little opportunity.

Chat with Ross

Judy

Simplicity is my specialty.

Chat with Judy

Add your answer:

Earn +20 pts

Q: What does state the key term mean?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Natural Sciences

What does it mean when something is raw?

When something is raw, it means that it has not been cooked or processed. It is in its natural state. This term is commonly used in relation to food.

What is avacation key mean?

It seems like there may be a typo or misunderstanding. There is no widely recognized concept or term called "avacation key" in the context of travel or vacations. It's possible you meant something else or could provide more context to clarify.

What is a key that switches between two states?

A toggle key is a key on a keyboard that switches between two states, typically on and off. Examples of toggle keys include the Caps Lock key and the Num Lock key. When pressed once, the key will activate a state, and pressing it again will deactivate that state.

What does non intoxicating mean?

Non-intoxicating means not causing a state of intoxication or impairment. This term is often used in reference to substances like CBD, which does not produce a "high" or altered state of mind associated with marijuana.

What do you call country that is surrounded by land?

If by "place" you mean a country or state...the term is "landlocked."

Trending Questions

What are the nine plants in order? What is plasma epinephrine effect? do rubbing sticks make fire? Why is the cuticle thicker on the upper surface than on the lower surface? Is asteroids surrounded by hydrogen clouds? Are all existing cells produced by other living cells or dead cells? What is the abstract noun for realistic? What is the movement of pollen from the anther of a plant to the pistol of the same plant? What is the fundamental building block of sequential logic? What is the mRNA strand for ggctatatcctgcgctatacgcta? What can a sand storm prepare? When mount tarawera exploded we called it an ...? What type of word is our? What is second level activities? What are the advantages of the simple stain technique over the negative stain technique? What is lysochrome? What are the 3 types of cellular transport that the plasma membrane controls? Is echinacea in the nightshade family? Where are the moss egg cells produced? What role does the cell wall department as a whole act to fulfill?

Related Questions

What does changing of state means?

what does the term change of state mean

What is the term that would mean the present is the key to the past?

Uniformatarianism.

Meaning of change of state?

what does the term change of state mean

What term mean state of being?

Existence

How do you spell out of state?

That is the correct spelling of the term "out of state." When used to mean beyond the borders of a nation-state, the term may be extraterritorial or transnational.

What does the term '' The key is inserted into the key-way of the plug mean?

It means you put the key in the lock. The plug is the name of the part of a lock cylinder that turns when you turn the key.

What does the term state of flux mean?

The term "state of flux" refers to a state of continual change and uncertainty. It often implies a lack of stability and a dynamic or volatile situation.

What do ovals mean on a Texas state map?

Look at the key on the map and it will tell you.

What is the term used to mean constant state of fluid balance?

Homeostasis

What does key mean in Punjabi?

In Punjabi, the word "key" is commonly used to refer to a lock or a key that opens a lock. Additionally, "key" can also be used as a metaphorical term, meaning something that is crucial or essential.

What is key terms?

THERE IS NO key term

What does peace dollar 1923 key date mean?

The term "key-date" means a more valuable or scarce coin of the series. But the 1923 issue is not one of them.

Still have questions?

imp

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.