0
Adrenine (A) pairs with Thymine (T)
Cytosine (C) pairs with Guanine (G)
Add your answer:
Earn +20 pts
How are base pairing rules and complementary base pairs related?
Base pairing rules dictate that in DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). These pairs are called complementary base pairs because they always bond together due to their specific chemical structures and hydrogen bonding capabilities. Together, these rules ensure the accurate replication and transcription of DNA.
Nucleotides in opposing strands of DNA that bind to each other are called?
Complementary base pairs.
A purine base that pairs with cytosine?
Adenine is the purine base that pairs with cytosine through hydrogen bonding in DNA. This base pairing is a key component of the complementary nature of DNA strands.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
What are the complementary base pairs in DNA?
The complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).
What are complementary base pairs and can you provide an example?
Complementary base pairs are nucleotide bases in DNA that always bond together in a specific way: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). An example of complementary base pairs is A-T and C-G.
What are the correct complementary base pairs in DNA?
The correct complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).
What is CCGTAGGCC?
CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).
What are complementary base-pairs?
Adrenine (A) pairs with Thymine (T) Cytosine (C) pairs with Guanine (G)
How are base pairing rules and complementary base pairs related?
Base pairing rules dictate that in DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). These pairs are called complementary base pairs because they always bond together due to their specific chemical structures and hydrogen bonding capabilities. Together, these rules ensure the accurate replication and transcription of DNA.
Nucleotides in opposing strands of DNA that bind to each other are called?
Complementary base pairs.
According to the rules of complementary base pairing a nucleotide containing the base cytosine would pair with a nucleotide containing the base of?
The base cytosine pairs with guanine via three hydrogen bonds. They are complementary base pairs in the DNA double helix.
What are base pairs in biotechnology?
In biotechnology, base pairs refer to the complementary pairing of nitrogenous bases in DNA molecules. Adenine pairs with thymine, and guanine pairs with cytosine. Understanding base pairs is crucial for techniques like PCR and DNA sequencing.
Assume that a section of double-stranded DNA contains 100 base pairs If 40 of the pairs contain base c how many pairs would contain base a?
If there are 40 pairs containing base C, the remaining pairs must contain the complementary base, G. Since each base pair must contain one A and one T (complementary to each other), the number of pairs containing base A would be the same as the number containing base T. Therefore, there would be 60 pairs containing base A.
A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?
The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.
What is the complementary base pairing between adenine and thymine in DNA?
Adenine pairs with thymine in DNA through hydrogen bonds, forming a complementary base pair.
