0
Adrenine (A) pairs with Thymine (T)
Cytosine (C) pairs with Guanine (G)
Jimmy Mueller
Wiki User
∙ 12y agoIn DNA adenine goes with thymine or A and T
guanine goes with cytosine or G and C
In RNA adenine is paired with uracil instead so A-U
but guanine and cytosine are still paired together ( G and C )
Add your answer:
Earn +20 pts
How are base pairing rules and complementary base pairs related?
Base pairing rules dictate that in DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). These pairs are called complementary base pairs because they always bond together due to their specific chemical structures and hydrogen bonding capabilities. Together, these rules ensure the accurate replication and transcription of DNA.
Nucleotides in opposing strands of DNA that bind to each other are called?
Complementary base pairs.
A purine base that pairs with cytosine?
Adenine is the purine base that pairs with cytosine through hydrogen bonding in DNA. This base pairing is a key component of the complementary nature of DNA strands.
What is the complementary base sequence of cagttagc-oh?
A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
What are complementary base-pairs?
Adrenine (A) pairs with Thymine (T) Cytosine (C) pairs with Guanine (G)
How are base pairing rules and complementary base pairs related?
Base pairing rules dictate that in DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). These pairs are called complementary base pairs because they always bond together due to their specific chemical structures and hydrogen bonding capabilities. Together, these rules ensure the accurate replication and transcription of DNA.
Nucleotides in opposing strands of DNA that bind to each other are called?
Complementary base pairs.
According to the rules of complementary base pairing a nucleotide containing the base cytosine would pair with a nucleotide containing the base of?
The base cytosine pairs with guanine via three hydrogen bonds. They are complementary base pairs in the DNA double helix.
Assume that a section of double-stranded DNA contains 100 base pairs If 40 of the pairs contain base c how many pairs would contain base a?
If there are 40 pairs containing base C, the remaining pairs must contain the complementary base, G. Since each base pair must contain one A and one T (complementary to each other), the number of pairs containing base A would be the same as the number containing base T. Therefore, there would be 60 pairs containing base A.
Which is true of the base pairing seen between two DNA strands?
In DNA, adenine pairs with thymine and cytosine pairs with guanine through hydrogen bonding. This complementary base pairing allows for accurate DNA replication during cell division.
If one strand of DNA has a nucleotide base sequence of tcaggtccat?
The complementary strand would have a nucleotide base sequence of agtccaggta. This is because adenine pairs with thymine, and guanine pairs with cytosine in DNA strands through hydrogen bonding.
A purine base that pairs with cytosine?
Adenine is the purine base that pairs with cytosine through hydrogen bonding in DNA. This base pairing is a key component of the complementary nature of DNA strands.
Due to the strict pairing of nitrogen base pairs in DNA molecules the two strands are said to be what to each other?
Complementary. The base pairs in DNA always follow a specific pairing rule (A with T, and C with G), which means that the sequence of bases on one strand determines the sequence on the other, making them complementary.
The complementary base pairs in a DNA molecule are stabilized by?
The complementary base pairs in a DNA molecule are stabilized by hydrogen bonds between adenine and thymine, and between cytosine and guanine. These hydrogen bonds help hold the two strands of DNA together in the double helix structure.
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.
What are the base pair rules for the nucleotides CGTA?
Cytosine (C) always pairs with guanine (G), and thymine (T) always pairs with adenine (A). This forms the complementary base pairs in DNA, where CG and TA are the base pairs.
