0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What does the complimentary strand look like for ccc-cga-ata?
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?
Transcription from the nucleotide sequence ATA would result in the mRNA codon UAU. This mRNA codon would then be translated during protein synthesis to produce the amino acid tyrosine.
What are the three types of mutation?
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
Which measuring system describe steam ATA as units?
Steam ATA is usually measured using the pressure unit of atmospheres (ATA). One atmosphere (ATM) is equal to the average pressure at sea level, which is approximately 14.7 pounds per square inch (psi) or 101.3 kilopascals (kPa).
Alma ata is the capital city of what country?
Alma-Ata is the former name of Almaty, which is the largest city in Kazakhstan and served as its capital until 1997.
Which strand of mrna would be made during transcription using the DNA strand ctg ata?
gac uau Gac uau GAC UAU
What does the complimentary strand look like for ccc-cga-ata?
The complimentary strand for ccc-cga-ata would be ggg-gct-tat. This is because DNA base pairing rules dictate that cytosine pairs with guanine and adenine pairs with thymine in DNA molecules.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA strand would be copied into a complementary RNA strand. The RNA produced would be complementary to the DNA sequence, so the RNA sequence would be AUGCGCGUAACAGCAGAUCCAAAGCUAUAUAUCGAUGCA. This RNA strand would carry the genetic information from the DNA to the ribosome for protein synthesis.
What would be the stand of complementary dna produced by the strand of dna shown below cgt ata?
Gca-tat gca ta The answer is AGC CT cat gt
What is the untranscribed DNA tac ttt ttc tgg ata aag gcg ctc cgg ata ccc ccg ttc auu?
aug aaa aag aac uau uuc cgc gag ggc uau ggg ggc aac aag uua
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What amino acid wuld be produced of transcrition takes place from a nucleotide with the three-base sequence ATA?
Transcription from the nucleotide sequence ATA would result in the mRNA codon UAU. This mRNA codon would then be translated during protein synthesis to produce the amino acid tyrosine.
What are the three types of mutation?
The three types of mutations are substitution (a single nucleotide is replaced with a different one), insertion (an extra nucleotide is added to the DNA sequence), and deletion (a nucleotide is removed from the DNA sequence).
Tyrosine anticodon is AUA what is DNA base triplet for its codon?
The DNA base triplet that corresponds to the AUA codon in mRNA is TAT.
What are four ATA standards for interfacing with hard drives?
paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc paralell ata ,serial ata, eide,ultra ata...etc
What would you break if you were celebrating Christmas in Mexico?
A piñata
What are series and parallel ports?
series is newer in ata like series ata and ata the old one is parallel ata
