0
Add your answer:
Earn +20 pts
Is A C a legitimate base pair?
No, A and C do not form a legitimate base pair in DNA. The complementary base pair for A is T, while the complementary base pair for C is G.
Do the rna nucleotides pair exactly as they were DNA replication?
No, RNA nucleotides in transcription pair with complementary DNA nucleotides according to the base pairing rules (A-U, G-C), as opposed to replicating DNA in which DNA nucleotides pair with complementary DNA nucleotides (A-T, G-C).
What type of base pairing occur during transcriptions?
the types that occur are complementary and antiparallel. For example, DNA A will pair with RNA U and DNA C will pair with RNA G.
In a DNA molecule what base pair could normally be composed of?
A DNA molecule can have base pairs composed of adenine (A) pairing with thymine (T), and guanine (G) pairing with cytosine (C). This is known as complementary base pairing in DNA.
Is cytosine not a nucleotide of DNA?
Cytosine is a nitrogenous base that is a component of DNA, but on its own, it is not a nucleotide. In DNA, cytosine pairs with guanine through hydrogen bonding to form a complementary base pair. Nucleotides are composed of a nitrogenous base, a sugar, and a phosphate group.
Is A C a legitimate base pair?
No, A and C do not form a legitimate base pair in DNA. The complementary base pair for A is T, while the complementary base pair for C is G.
What do thymine mean?
Thymine is the complementary base pair for adenine in DNA.
What would be the base sequence for the complementary DNA formed from CGT TA?
The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.
Do the rna nucleotides pair exactly as they were DNA replication?
No, RNA nucleotides in transcription pair with complementary DNA nucleotides according to the base pairing rules (A-U, G-C), as opposed to replicating DNA in which DNA nucleotides pair with complementary DNA nucleotides (A-T, G-C).
Guanine is a complementary base for which of these DNA nucleotides?
Guanine is a complementary base for cytosine in DNA.
What type of base pairing occur during transcriptions?
the types that occur are complementary and antiparallel. For example, DNA A will pair with RNA U and DNA C will pair with RNA G.
What are the two pairs of stable Watson-Crick complementary DNA base pair?
They are: - Adenine and thymine - Cytosine and guanine
What base pairs with Adenine in RNA?
In RNA, adenine base pairs with uracil, not thymine as in DNA. This forms an A-U base pair, where adenine and uracil are complementary bases.
Uracil will pair with what other on DNA?
Uracil is the base used in messenger RNA in place of thymine, and is complementary to adenine.
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
CTGTAGCAACTGATGCCTACTAG The complementary DNA strand is formed by pairing adenine with thymine and cytosine with guanine. Simply replace each base with its complementary pair: A with T, T with A, C with G, and G with C.
In a DNA molecule what base pair could normally be composed of?
A DNA molecule can have base pairs composed of adenine (A) pairing with thymine (T), and guanine (G) pairing with cytosine (C). This is known as complementary base pairing in DNA.
According to the rules of complementary base pairing a nucleotide containing the base cytosine would pair with a nucleotide containing the base of?
The base cytosine pairs with guanine via three hydrogen bonds. They are complementary base pairs in the DNA double helix.
