0
adenine and thymine, cytosine and guanine or a pairs with t and c pairs with g
Wiki User
∙ 13y ago
Add your answer:
Earn +20 pts
Is A C a legitimate base pair?
No, A and C do not form a legitimate base pair in DNA. The complementary base pair for A is T, while the complementary base pair for C is G.
Do the rna nucleotides pair exactly as they were DNA replication?
No, RNA nucleotides in transcription pair with complementary DNA nucleotides according to the base pairing rules (A-U, G-C), as opposed to replicating DNA in which DNA nucleotides pair with complementary DNA nucleotides (A-T, G-C).
What type of base pairing occur during transcriptions?
the types that occur are complementary and antiparallel. For example, DNA A will pair with RNA U and DNA C will pair with RNA G.
In a DNA molecule what base pair could normally be composed of?
A DNA molecule can have base pairs composed of adenine (A) pairing with thymine (T), and guanine (G) pairing with cytosine (C). This is known as complementary base pairing in DNA.
Is cytosine not a nucleotide of DNA?
Cytosine is a nitrogenous base that is a component of DNA, but on its own, it is not a nucleotide. In DNA, cytosine pairs with guanine through hydrogen bonding to form a complementary base pair. Nucleotides are composed of a nitrogenous base, a sugar, and a phosphate group.
Is A C a legitimate base pair?
No, A and C do not form a legitimate base pair in DNA. The complementary base pair for A is T, while the complementary base pair for C is G.
What do thymine mean?
Thymine is the complementary base pair for adenine in DNA.
What type of base pairing occur during transcriptions?
the types that occur are complementary and antiparallel. For example, DNA A will pair with RNA U and DNA C will pair with RNA G.
Guanine is a complementary base for which of these DNA nucleotides?
Guanine is a complementary base for cytosine in DNA.
What are the two pairs of stable Watson-Crick complementary DNA base pair?
They are: - Adenine and thymine - Cytosine and guanine
What base pairs with Adenine in RNA?
In RNA, adenine base pairs with uracil, not thymine as in DNA. This forms an A-U base pair, where adenine and uracil are complementary bases.
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
CTGTAGCAACTGATGCCTACTAG The complementary DNA strand is formed by pairing adenine with thymine and cytosine with guanine. Simply replace each base with its complementary pair: A with T, T with A, C with G, and G with C.
Uracil will pair with what other on DNA?
Uracil is the base used in messenger RNA in place of thymine, and is complementary to adenine.
In a DNA molecule what base pair could normally be composed of?
A DNA molecule can have base pairs composed of adenine (A) pairing with thymine (T), and guanine (G) pairing with cytosine (C). This is known as complementary base pairing in DNA.
According to the rules of complementary base pairing a nucleotide containing the base cytosine would pair with a nucleotide containing the base of?
The base cytosine pairs with guanine via three hydrogen bonds. They are complementary base pairs in the DNA double helix.
Why cant thymine and guanine pair?
Thymine and guanine cannot pair because they do not form complementary base pairs in DNA. In DNA, adenine pairs with thymine and guanine pairs with cytosine due to hydrogen bonding properties. Thus, thymine and guanine are not complementary bases and cannot form a stable base pair.
What does cytosine always pair with?
Cytosine always pairs with guanine in DNA through hydrogen bonding, forming a stable base pair. This complementary base pairing is a key feature in the double-stranded structure of DNA.
