Want this question answered?
Be notified when an answer is posted
It's GTTCATCCGA
The process where DNA is copied is called DNA replication. During DNA replication, the double-stranded DNA molecule is unwound and each strand serves as a template for the synthesis of a new complementary strand. This process is essential for cell division and passing genetic information to offspring.
The mRNA sequence transcribed from the DNA sequence "a t a t g c g c t a a a" would be "u a u a c g c g a u u u", where "u" represents uracil in RNA and is complementary to adenine in DNA.
The complement of the DNA sequence c t a g c is g a t c g. Each nucleotide in the original sequence is paired with its complementary nucleotide: cytosine with guanine, thymine with adenine, and adenine with thymine.
AGCU or AGCT are letters that stand for 4 nucleobases. In RNA, the bases are Adenine, Guanine, Cytosine, and Uracil (RNA bases). In DNA, the bases are Adenine, Guanine, Cytosine, and Thymine (DNA bases).
The complementary strand to the given DNA sequence would be C T A G G T A C T C A A T G. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine.
C-G-A-T-T-A-G-G-C
cytosine, guanine, adenine, thymine
A binds to T and C binds to G. Therefore the complementary strand to ATT-CGC is TAA-GCG.
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
The DNA sequence provided is: TTCGAGACTTAGTCGGATGTGAAGTGGTGTATT To replicate this DNA sequence, the double-stranded DNA unwinds, and new DNA strands are synthesized using the original strands as templates. Adenine pairs with thymine and cytosine pairs with guanine, following the base pairing rules. This results in two identical DNA molecules, each containing one original strand and one newly synthesized strand.
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
The correct DNA complement of the given DNA strand is 3 c t a g c c a t g t c a 5. DNA strands complement each other by matching adenine with thymine and cytosine with guanine.
It's GTTCATCCGA
The complementary DNA strand to "ttgccagc" is "aaggctcg". In complementary base pairing, thymine (T) pairs with adenine (A) and guanine (G) pairs with cytosine (C).
A to T, T to A, G to C, C to G