0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is the name given to the process where the DNA is copied?
The process where DNA is copied is called DNA replication. During DNA replication, the double-stranded DNA molecule is unwound and each strand serves as a template for the synthesis of a new complementary strand. This process is essential for cell division and passing genetic information to offspring.
What is the sequence of the mRna produced from the strand of DNA a t a t g c g c t a a a?
The mRNA sequence transcribed from the DNA sequence "a t a t g c g c t a a a" would be "u a u a c g c g a u u u", where "u" represents uracil in RNA and is complementary to adenine in DNA.
What is Compliment of c t a g c?
The complement of the DNA sequence c t a g c is g a t c g. Each nucleotide in the original sequence is paired with its complementary nucleotide: cytosine with guanine, thymine with adenine, and adenine with thymine.
What are the 4 letters of the DNA code?
AGCU or AGCT are letters that stand for 4 nucleobases. In RNA, the bases are Adenine, Guanine, Cytosine, and Uracil (RNA bases). In DNA, the bases are Adenine, Guanine, Cytosine, and Thymine (DNA bases).
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
The complementary strand to the given DNA sequence would be C T A G G T A C T C A A T G. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine.
What is the DNA code for A-T-C-G-A?
C-G-A-T-T-A-G-G-C
What does a-t and c-g stand for in DNA?
cytosine, guanine, adenine, thymine
What is complement to a parent stand of dna that is A-T-T-C-G-C?
A binds to T and C binds to G. Therefore the complementary strand to ATT-CGC is TAA-GCG.
What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?
The complementary strand for CGATTAC would be GCTAATG. C and G are always paired together, and A and T are always paired together.
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
The DNA sequence provided is: TTCGAGACTTAGTCGGATGTGAAGTGGTGTATT To replicate this DNA sequence, the double-stranded DNA unwinds, and new DNA strands are synthesized using the original strands as templates. Adenine pairs with thymine and cytosine pairs with guanine, following the base pairing rules. This results in two identical DNA molecules, each containing one original strand and one newly synthesized strand.
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
The nonsense strand of the given DNA sequence T-A-C-C-A-A-G-C-T-A-C-C-T-A-T-T-A-A-C-C-G is T-A-G-G-T-T-C-G-A-T-G-G-A-T-A-A-T-G-G-C. This sequence represents the complementary base pairs to the original sequence, following the A-T and G-C base pairing rule.
What is the correct DNA complement of the DNA strand 5 g a t c g g t a c a g t g 3?
The correct DNA complement of the given DNA strand is 3 c t a g c c a t g t c a 5. DNA strands complement each other by matching adenine with thymine and cytosine with guanine.
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is a complementary DNA strand using a t t g c c a g c?
The complementary DNA strand to "ttgccagc" is "aaggctcg". In complementary base pairing, thymine (T) pairs with adenine (A) and guanine (G) pairs with cytosine (C).
What is the structure of the DNA loop?
A to T, T to A, G to C, C to G
