Wiki User
∙ 14y agoaug-gga-aau-cau-cgg-uga
In RNA there's no 't' so you use a 'u' instead.
For DNA:
'a' goes with 't'
'c' goes with 'g'
***Remember AT&T for the pairing, and then the other two letters just match up.***
For DNA into RNA:
'a' goes with 'u'
'c' goes with 'g'
Wiki User
∙ 14y agoThe DNA sequence is transcribed into RNA by replacing thymine (T) with uracil (U). So, the RNA sequence produced from 3'-taccctttagtagccact-5' DNA would be 5'-augggaaaucucagguga-3'.
Wiki User
∙ 14y agoaug-gga-aau-cgg-uca
Thymine is replaced by Uramine in the RNA sequence.
The different sets of 3 will tell you what kind of amino acid this string of RNA will produce.
Wiki User
∙ 10y ago3'-T A C C C T T T A G T A G C C A C T-5'
Wiki User
∙ 14y ago5- augggaaaucaucgguga-3
Wiki User
∙ 15y agoA codon
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
gaugcgauccguaaucugaccau
Transcription from the nucleotide sequence ATA would result in the mRNA codon UAU. This mRNA codon would then be translated during protein synthesis to produce the amino acid tyrosine.
The opposing base pairs for the sequence ATCG in DNA would be TAGC. Adenine pairs with thymine, and cytosine pairs with guanine in DNA.
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
Transcription produces a strand of messenger RNA that is complementary to the DNA that it transcribed. For example, the DNA sequence AGTCGA would be transcribed by messenger RNA as UCAGCU.
gaugcgauccguaaucugaccau
When RNA's base sequence is used to determine the base sequence of a new strand of DNA, that is called reverse transcription.This is because the process is the reverse of transcription, which involves copying the base sequence of DNA to form RNA, including messenger RNA (mRNA).
If DNA has the sequence AAA, the corresponding mRNA segment would have the sequence UUU due to complementary base pairing during transcription. This mRNA sequence would then undergo translation in order to produce a protein based on the genetic information contained in the DNA.
Transcription.During transcription the base sequence (genetic code) of part (a gene) of one strand of DNA is copied onto a strand of RNA as the RNA is synthesized.
Transcription produces MRNA.
Transcription from the nucleotide sequence ATA would result in the mRNA codon UAU. This mRNA codon would then be translated during protein synthesis to produce the amino acid tyrosine.
The opposing base pairs for the sequence ATCG in DNA would be TAGC. Adenine pairs with thymine, and cytosine pairs with guanine in DNA.
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The opposite strand of a DNA sequence will have complementary nucleotides. In this case, the sequence of the base pairs on the opposite strand of AGCTCAG would be TCGAGTC.
The mRNA will have codons AUG-CCA-GUA-GGC-CAC
ATAGCC is complementary to the base sequence TATCGG.