0
First, you must understand that a strand of mRNA, is the complement of one side (the left) of DNA. Basically, you take the one side of the DNA strand and complement it by using these pairs: Adenine:Uracil, Cytosine:Guanine, Thymine:Adenine.
They are all usually abbreviated by their first letter.
Second, in order to find the mRNA, you must understand the process of protein synthesis. If you know the process, then it should be clear that the mRNA is made from one side of the DNA strand during the transcription. It then moves out of the cell and into the cytoplasm to start translation.
To find the mRNA strand from a DNA strand, you simply transcribe the DNA sequence using the complementary RNA base pairs. Replace thymine (T) in DNA with uracil (U) in RNA. This process results in the mRNA strand that is complementary to the original DNA sequence.
Because DNA does not leave the nucleus, and protein synthesis occurs on the ribosomes in the cytoplasm and rough ER. The mRNA is able to leave the nucleus and go to the ribosomes.
cause they both have guanine, cytosine plus I am not sure I got this right so fingers cross
Add your answer:
Earn +20 pts
How is dna made into mRNA?
DNA is first transcribed into mRNA by an enzyme called RNA polymerase. During transcription, RNA polymerase reads the DNA sequence and generates a complementary mRNA strand. This mRNA strand then leaves the nucleus and enters the cytoplasm for translation into proteins.
Which strand of DNA transcribes into mRNA?
The template strand of DNA is the one that is transcribed into mRNA. This strand is complementary to the mRNA sequence, allowing for the correct base pairing during transcription.
What enzyme is responsible for decodingthe DNA strand into an mRNA?
The enzyme responsible for decoding the DNA strand into an mRNA is called RNA polymerase. It catalyzes the synthesis of mRNA during transcription by matching complementary RNA nucleotides with the DNA template strand.
What transcribes mRNA?
DNA transcribes mRNA through a process called transcription. The enzyme RNA polymerase synthesizes the mRNA by reading the DNA template strand and creating a complementary RNA strand. This mRNA molecule carries the genetic information from the DNA to be translated into proteins in the cell.
If DNA is described as a double helix how should mRNA be described-?
mRNA is like a single strand instead of a double strand. If DNA is like a twisted ladder, then mRNA is like a single half of that ladder, with only half the bases.
How is dna made into mRNA?
DNA is first transcribed into mRNA by an enzyme called RNA polymerase. During transcription, RNA polymerase reads the DNA sequence and generates a complementary mRNA strand. This mRNA strand then leaves the nucleus and enters the cytoplasm for translation into proteins.
A DNA strand with the base sequence tgacgca codes for a strand of mrna the mrna will have what base sequence?
The mRNA sequence generated from the DNA strand tgacgca would be acugcgu. This is because mRNA is complementary to the DNA template strand, so DNA base T pairs with mRNA base A, DNA base G pairs with mRNA base C, DNA base A pairs with mRNA base U, and DNA base C pairs with mRNA base G.
Name of the DNA strand which is copied to make mRNA?
The DNA strand that is copied to make mRNA is the template strand of the gene. This strand serves as a template for the RNA polymerase enzyme to synthesize a complementary mRNA strand during the process of transcription.
Difference between sense and anti sense strands of DNA?
The sense strand of DNA is the strand that has the same sequence as the mRNA that is transcribed from DNA. The antisense strand is the complementary strand of the sense strand, which is used as a template for mRNA synthesis. The mRNA is transcribed from the antisense strand and contains the same sequence as the sense strand.
How many strand of mRNA are transcribed from the two unzipped strands of DNA?
One mRNA strand is made.
Which strand of DNA transcribes into mRNA?
The template strand of DNA is the one that is transcribed into mRNA. This strand is complementary to the mRNA sequence, allowing for the correct base pairing during transcription.
What is formed when reverse transcriptase is used on of strand of mrna?
A strand of DNA
What is formed when reverse transcriptase is used on strand of mrna?
A strand of DNA
What is the mRNA of the DNA strand aatcgtttaaatatattgggcccgggcccggggcgcg?
UUAGCAAAUUUAUAUAACCCGGGCCCGGGCCCCGCGC
What is formed when reverse transcriptase is used on a strand of mRNA?
A strand of DNA
Which type of mRNA nucleotide pairs thymine in the DNA strand?
Uracil pairs with adenine in mRNA and replaces thymine in the DNA strand during transcription.
The strand of DNA that is not transcribed is called the strand.?
The strand of DNA that is not transcribed is called the coding strand. This strand serves as the template for mRNA synthesis during transcription. The opposite strand, which is transcribed into mRNA, is known as the template strand.
