Rung on a ladder and wrung for twisted.
The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.
The homophone for "step of a ladder" and "twisted" is "rung."
The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.
The homophone for the step of a ladder is "steppe." A homophone is a word that sounds the same as another word but has a different meaning and often a different spelling. In this case, "step" refers to a part of a ladder or staircase, while "steppe" refers to a large area of flat unforested grassland.
Rung on a ladder and wrung for twisted.
The homophone of the step of a ladder and "twisted" is "stair." Homophones are words that sound the same but have different meanings, origins, or spellings. In this case, "step" can refer to a part of a ladder or a movement with the foot, while "stair" refers to a series of steps in a building. "Twisted" describes something that is coiled or rotated.
Rung on a ladder and wrung for twisted.
The homophone for "step of a ladder" and "twisted" is "rung."
The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.
Watson and Crick named the twisted-ladder structure of DNA as a "double helix".
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
It appears to have a double helix shape, similar to the structure of DNA.
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
a ladder being twisted
The rungs of a ladder are the steps. Unless it is a step ladder, then they are just steps.
It prevents the step ladder from toppling over.