0
Add your answer:
Earn +20 pts
What is the homophone for the step of a ladder twisted?
Rung on a ladder and wrung for twisted.
What is the homophone fot the step of a ladder and twisted?
The homophone for "step of a ladder" and "twisted" is "rung."
What is the homophone of the step of a ladder and twisted?
The homophone of "step" (as in a ladder) is "staip," and the homophone of "twisted" is "twistid."
What is the homophone for a step of a ladder and twisted?
The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.
What is the homophone for the step of a ladder?
The homophone for the step of a ladder is "steppe." A homophone is a word that sounds the same as another word but has a different meaning and often a different spelling. In this case, "step" refers to a part of a ladder or staircase, while "steppe" refers to a large area of flat unforested grassland.
What is the homophone for the step of a ladder twisted?
Rung on a ladder and wrung for twisted.
What is homophone the step of a ladder twisted?
Rung on a ladder and wrung for twisted.
What is the homophone fot the step of a ladder and twisted?
The homophone for "step of a ladder" and "twisted" is "rung."
What is the homophone of the step of a ladder and twisted?
The homophone of "step" (as in a ladder) is "staip," and the homophone of "twisted" is "twistid."
What is the homophone for a step of a ladder and twisted?
The homophone for a step of a ladder and "twisted" is "rung." A rung is a horizontal support on a ladder that you step on, while "wrung" is the past tense of the verb "wring," meaning to twist or squeeze something forcefully. The similarity in pronunciation between "rung" and "wrung" makes them homophones, despite their different meanings.
What was Watson and cricks name for twisted-ladder of DNA?
Watson and Crick named the twisted-ladder structure of DNA as a "double helix".
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What general shape does this fragment of DNA resemble?
It appears to have a double helix shape, similar to the structure of DNA.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What does the double helix resemble?
a ladder being twisted
What is another name for a ladder rung?
The rungs of a ladder are the steps. Unless it is a step ladder, then they are just steps.
What is best why to support a step ladder?
It prevents the step ladder from toppling over.
