Tags Biology Genetics Genetic Engineering

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

Subjects>Science>Engineering

What is a double helix where genetic code is found?

Anonymous

∙ 16y ago

Updated: 8/10/2023

Very simply put, a gene is a region of DNA that codes for a protein DNA is composed of 4 different nucleotide bases- guanine, adenine, thymine, and cytosine. A group of three of these is called a codon. A codon codes for a particular amino acid. A protein is composed of a chain of amino acids put together in the codons are in. Therefore the genetic information is the sequence of codons and by extension the sequence of nucleotide bases.

Wiki User

∙ 12y ago

Still curious? Ask our experts.

Chat with our AI personalities

Ross

Every question is just a happy little opportunity.

Chat with Ross

Taiga

Every great hero faces trials, and you—yes, YOU—are no exception!

Chat with Taiga

Steve

Knowledge is a journey, you know? We'll get there.

Chat with Steve

More answers

The double helix is the construction of DNA where all genetic code is found.

Wiki User

∙ 16y ago

it is complicated but we recall the nucleus is a small spherical and helix is in dna. dna helix is actually made of reapeating units called nucleotides.

Wiki User

∙ 12y ago

The double helix IS DNA - its what the spiral structure of the DNA is called. :) hope it helped

Wiki User

∙ 14y ago

DNA.

Wiki User

∙ 14y ago

DNA

Wiki User

∙ 14y ago

Add your answer:

Earn +20 pts

Q: What is a double helix where genetic code is found?

Write your answer...

Submit

Still have questions?

imp

Continue Learning about Engineering

On what molecule is the genetic code of the cell found?

Genetic code of the cell is found in a long molecule known as DNA.

What is a double walled structure containing the cells genetic code?

The cell membrane is a double-walled structure containing a cell's genetic code.

Is DNA genetic code or genetic blueprint?

DNA is the genetic code

What is secondary genetic code?

The secondary genetic code is the folding of protein.

Is the genetic code is arbitrary?

why genetic code is arbitraryif yesthen prov ur anser

Trending Questions

What does visual sources mean? What is the difference between an inventor and a scientist? What is the average cost per square foot for concrete floor cleaning with some mold removal by a professional? What are Edward Jenner inventions? The A to Z of technical writing? Is man the master or slave of modern technology? What is smart concrete and its advantages? How do you upload on virtual university webpage? What are example of second generation programming language? Will the output voltage be stepped up the same canceled or stepped down compared to the input voltage if both coils of a transformer have the same number of turns? Why isn't main a keyword in c? Minimum grade of concrete for prestressing? How do simple machines change the force? Does anyone have a picutre of the Leviton 382 push switch not to be confused with the Leviton 9382? Can you trefoil same phase cables? What type of pipes is called steam pipe or what is the specification of a steam pipe? What happens if load of DC series motor is disconnected? Does a architect use science? How do you build a hydraulic excavator for a school project? What does a transistor look like?

Related Questions

Why is DNA shaped like a double helix?

DNA is shaped like a double helix because this structure allows it to store genetic information in a compact and stable way. The double helix shape helps protect the genetic code and allows for easy access when needed for processes like replication and protein synthesis.

What did the double helix model help explain?

The double helix model of DNA helped explain how genetic information is stored and replicated in organisms. It also provided insight into how mutations occur and how variations in genes contribute to inheritance and evolution. Additionally, the structure of DNA as a double helix helped scientists understand how proteins are made based on the genetic code.

What is the significance of the double helix molecule in the structure of DNA?

The double helix structure of DNA is significant because it allows for the molecule to store and transmit genetic information in a stable and efficient manner. The twisted ladder shape of the double helix provides a protective housing for the genetic code, ensuring that it is accurately replicated and passed on to future generations. This structure also allows for easy access to the genetic information when needed for processes such as protein synthesis.

Which organic molecule contains your genetic code?

The genetic code is contained in the molecule called DNA (deoxyribonucleic acid). DNA is a long, double-helix structure that carries the genetic instructions used in the development, functioning, growth, and reproduction of all known living organisms.

What four chemicals make up the genetic code?

Adenine, Thymine, Cytosine, and Guanine are the four chemicals that make up the genetic code in DNA. These nucleotides pair in a specific way to form the double helix structure of DNA, which carries genetic information in living organisms.

How do nitrogen bases along a gene serve as a genetic code?

Nitrogen bases along a gene, like A, T, C, and G, form the genetic code by encoding the instructions for making proteins. They are read in groups of three called codons. Each codon corresponds to a specific amino acid, which is the building block of proteins.

On what molecule is the genetic code of the cell found?

Genetic code of the cell is found in a long molecule known as DNA.

What is a double walled structure containing the cells genetic code?

The cell membrane is a double-walled structure containing a cell's genetic code.

What role did Francis crick have in the discovery on dna?

Francis Crick is co-discoverer of the double helix structure of DNA, along with James Watson. He played a pivotal role in research related to sequencing the genetic code.

What did Watson and crick think DNA looked like?

Watson and Crick proposed a double helix structure for DNA, with two strands that twist around each other. Their model showed how the bases adenine, thymine, cytosine, and guanine pair up to form the genetic code. This discovery revolutionized biology and laid the foundation for understanding how genetic information is stored and passed on.

The chromosomes in the nucleus of a cell contains a code known as?

The Genetic code.DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:ACCTAATCAGAATAAACCACA (and so on)the proteins attach in a line AND from one helix to the other.A - G| |T - C| |C - A| |G - Aand so on - it spins downward.

What is the DNA code best described as?

The DNA code is a set of instructions that determines the genetic makeup of all living organisms. It is composed of four nucleotide bases (adenine, thymine, cytosine, and guanine) that form a double helix structure. These bases pair up in a specific way to carry genetic information.

Still have questions?

imp

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.