0
Very simply put, a gene is a region of DNA that codes for a protein DNA is composed of 4 different nucleotide bases- guanine, adenine, thymine, and cytosine. A group of three of these is called a codon. A codon codes for a particular amino acid. A protein is composed of a chain of amino acids put together in the codons are in. Therefore the genetic information is the sequence of codons and by extension the sequence of nucleotide bases.
The double helix is the construction of DNA where all genetic code is found.
it is complicated but we recall the nucleus is a small spherical and helix is in dna. dna helix is actually made of reapeating units called nucleotides.
The double helix IS DNA - its what the spiral structure of the DNA is called. :) hope it helped
Add your answer:
Earn +20 pts
What is a double walled structure containing the cells genetic code?
The cell membrane is a double-walled structure containing a cell's genetic code.
On what molecule is the genetic code of the cell found?
Genetic code of the cell is found in a long molecule known as DNA.
Is DNA genetic code or genetic blueprint?
DNA is the genetic code
What is secondary genetic code?
The secondary genetic code is the folding of protein.
Is the genetic code is arbitrary?
why genetic code is arbitraryif yesthen prov ur anser
What did the double helix model help explain?
The double helix model of DNA helped explain how genetic information is stored and replicated in organisms. It also provided insight into how mutations occur and how variations in genes contribute to inheritance and evolution. Additionally, the structure of DNA as a double helix helped scientists understand how proteins are made based on the genetic code.
Which organic molecule contains your genetic code?
The genetic code is contained in the molecule called DNA (deoxyribonucleic acid). DNA is a long, double-helix structure that carries the genetic instructions used in the development, functioning, growth, and reproduction of all known living organisms.
What four chemicals make up the genetic code?
Adenine, Thymine, Cytosine, and Guanine are the four chemicals that make up the genetic code in DNA. These nucleotides pair in a specific way to form the double helix structure of DNA, which carries genetic information in living organisms.
How do nitrogen bases along a gene serve as a genetic code?
Nitrogen bases along a gene, like A, T, C, and G, form the genetic code by encoding the instructions for making proteins. They are read in groups of three called codons. Each codon corresponds to a specific amino acid, which is the building block of proteins.
What is a double walled structure containing the cells genetic code?
The cell membrane is a double-walled structure containing a cell's genetic code.
On what molecule is the genetic code of the cell found?
Genetic code of the cell is found in a long molecule known as DNA.
What role did Francis crick have in the discovery on dna?
Francis Crick is co-discoverer of the double helix structure of DNA, along with James Watson. He played a pivotal role in research related to sequencing the genetic code.
What did Watson and crick think DNA looked like?
Watson and Crick proposed a double helix structure for DNA, with two strands that twist around each other. Their model showed how the bases adenine, thymine, cytosine, and guanine pair up to form the genetic code. This discovery revolutionized biology and laid the foundation for understanding how genetic information is stored and passed on.
The chromosomes in the nucleus of a cell contains a code known as?
The Genetic code.DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:ACCTAATCAGAATAAACCACA (and so on)the proteins attach in a line AND from one helix to the other.A - G| |T - C| |C - A| |G - Aand so on - it spins downward.
What is the DNA code best described as?
The DNA code is a set of instructions that determines the genetic makeup of all living organisms. It is composed of four nucleotide bases (adenine, thymine, cytosine, and guanine) that form a double helix structure. These bases pair up in a specific way to carry genetic information.
What is the name of the twisted ladder shape of a DNA molecule?
The twisted ladder shape of a DNA molecule is called a double helix. The double helix structure consists of two strands that are twisted around each other, forming a shape resembling a twisted ladder or spiral staircase. This iconic structure was first described by James Watson and Francis Crick in 1953, revolutionizing our understanding of genetics.
Why is RNA now thought to be the first genetic code?
RNA is thought to be the first genetic code because it can store genetic information like DNA, catalyze chemical reactions like proteins, and can replicate itself. These properties suggest that RNA could have played a role in an early form of self-replicating life before the evolution of more complex genetic systems.
