0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
Could DNA be amplified with only one primer?
No because it changes letters so the primer will not be the correct match. They have to be different.For example, the original DNA strand is AATGCGTACTAGCTAGTCTTAGTC and the primer is TTACGC. There is no other match to the DNA strand so a new one will have to be used.
What selector in HTML is used to match any element in the hierarchy?
The * selector is used to match any element in the hierarchy.
How match 2 phase line voltage between them?
To match 2 phase line voltage it has to be the same voltage.
Can you use b type thermocouple extension wire for a s type thermocouple?
No If you want to maintain reasonable accuracy you must use the correct type of compensating or extension cable to match the sensor. The accuracy of the system depends on all system components. The output is generated when the wires are in thermal gradients, so if there is any thermal gradient across the compensating/extension cable you will get errors if you do not use the correct type www.peaksensors.co.uk
How do you use the longest Prefix Match algorithm in C programming?
You can use the longest Prefix Match algorithm in C programming by looking up the longest standard Python package match and then converting that from Python into C or C++ to figure out how to create the equivalent.
Which is correct assist a match or attend a match?
A spectator attends a match.
What is the correct match?
well it depends what you mean by what is the correct "match" because if you explained what the match was it might be a lot easier to answer. sincerely Elmo the 2nd of Austin,Texas
What is the correct statment of yesterday's watch match you did.?
"Did you watch yesterday's match?"
Quiz?
Examples of code will be shown. match it to the correct vocabulary. Variables are represented by ()
Which of these is a correct match of author and novel?
not mt
Yes it does. You just choose the correct size tip and voltage to match your Asus?
Yes it does. You just choose the correct size tip and voltage to match your Asus
How do you beat fashion spy dress for danger?
you have to match the correct item of clothing with the correct color
What actors and actresses appeared in A Runaway Match - 1921?
The cast of A Runaway Match - 1921 includes: George Bunny
What would be a correct match with regard to location?
A correct match would be when two or more items are aligned or paired accurately based on a specific criteria, such as geographical coordinates, addresses or landmarks. Matching the location of a specific place on a map with its corresponding GPS coordinates would be an example of a correct location match.
Help you match each author with correct era?
You can match authors with the correct era by visiting your local library. A librarian can help you find all you need to know about each author and their works.
Is a correct match with regard to location?
A location match is often expected on online map programs. The user puts in their starting and ending location, and expects the program to match it.
What is a correct match with regard to location?
A location match is often expected on online map programs. The user puts in their starting and ending location, and expects the program to match it.
