0
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
Add your answer:
Earn +20 pts
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is GAATTC?
GAATTC is a recognition sequence for the restriction enzyme EcoRI, commonly used in molecular biology for cutting DNA at specific sites. The sequence is 5'-GAATTC-3', which is 6 base pairs long and forms a palindromic sequence.
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The complementary DNA strand would be TACCGGATC. DNA base pairs follow specific rules: A pairs with T and G pairs with C.
How does DNA template dictate the sequence of the RNA produced?
During transcription, the DNA template dictates the sequence of the RNA produced by complementary base pairing. RNA polymerase reads the DNA template strand and adds complementary RNA nucleotides (A, U, G, C) to assemble the RNA molecule. This process ensures that the RNA sequence matches the non-template DNA strand.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
What is the complimentary sequence of ATCGGCTT?
The complimentary sequence of ATCGGCTT will be TAGCCGAA. Because A pairs with T (2 hydrogen bonds), C pairs with G (3 hydrogen bond).
What is GAATTC?
GAATTC is a recognition sequence for the restriction enzyme EcoRI, commonly used in molecular biology for cutting DNA at specific sites. The sequence is 5'-GAATTC-3', which is 6 base pairs long and forms a palindromic sequence.
Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?
3-gttcacctta-5
Convert the following DNA sequence into its RNA equivalent and then using the genetic code convert that RNA sequence into the amino acid sequence 5tacttcttcaagact-3?
DNA Sequence = 5tacttcttcaagact-3 RNA Sequence = 3'-AUGAAGAAGUUCUGA-5'You just switch 5' and 3'T becomes AA becomes UC becomes GG becomes CThere should be no Ts in an RNA sequence.
If the base sequence of the DNA is gtcaggatc what would be the corresponding base sequence of the messenger rna?
The corresponding base sequence of messenger RNA (mRNA) would be caguccuag. This is because RNA replaces thymine (T) with uracil (U) when transcribing DNA, so the corresponding Uracil to Adenine, Guanine to Cytosine, Thymine to Adenine, Cytosine to Guanine and Adenine to Uracil.
Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?
5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....
How would the following base sequence be coded for in mrna cag tgc acg?
Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.
If the partial sequence A of rRNA to be detected in environmental engineering system is shown 5'-cggguuagcgcaccgc-3' Design the oligonucleotide probe for the detection of the sequence A only?
8
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The complementary DNA strand would be TACCGGATC. DNA base pairs follow specific rules: A pairs with T and G pairs with C.
How does DNA template dictate the sequence of the RNA produced?
During transcription, the DNA template dictates the sequence of the RNA produced by complementary base pairing. RNA polymerase reads the DNA template strand and adds complementary RNA nucleotides (A, U, G, C) to assemble the RNA molecule. This process ensures that the RNA sequence matches the non-template DNA strand.
What describes the paring of DNA bases?
Complimentary base pairs are paired as: A with T by 2 hydrogen bonds. C with G by 3 hydrogen bonds.
