answersLogoWhite

0

5' TGACATGCAT 3'

The sequence is complementary and in the correct orientation.

User Avatar

Wiki User

12y ago

What else can I help you with?

Related Questions

What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complimentary sequence of ATCGGCTT?

The complimentary sequence of ATCGGCTT will be TAGCCGAA. Because A pairs with T (2 hydrogen bonds), C pairs with G (3 hydrogen bond).


What is GAATTC?

It is a sequence of DNA that is also a palindrom. i.e. the complimentary sequence of DNA would read the same way (but in the other direction). g a a t t c c t t a a g Moreover it is the sequence of DNA recognised by the restriction endonuclease EcoR1, the first such enzyme to be discovered. These enzymes have been important tools in science allowing pieces of DNA to be specifically excised and manipulated.


How many nucleotides are present in the DNA sequence?

The number of nucleotides in a DNA sequence can vary, but in general, a human DNA molecule contains about 3 billion nucleotides.


What is the recognition sequence for the BamHI cut site in DNA?

The recognition sequence for the BamHI cut site in DNA is 5'-GGATCC-3'.


Match this sequence of DNA 5-caagtggaat-3 with its complementary DNA strand?

3-gttcacctta-5


Convert the following DNA sequence into its RNA equivalent and then using the genetic code convert that RNA sequence into the amino acid sequence 5tacttcttcaagact-3?

DNA Sequence = 5tacttcttcaagact-3 RNA Sequence = 3'-AUGAAGAAGUUCUGA-5'You just switch 5' and 3'T becomes AA becomes UC becomes GG becomes CThere should be no Ts in an RNA sequence.


If the base sequence of the DNA is gtcaggatc what would be the corresponding base sequence of the messenger rna?

Wrong. UAC is the complimentary base sequence on the mRNA strand. RNA does not use the T nucleotide don u think if it should be written like CAU coz rna polymerase reads 3 to 5 and gives 5 to 3


Along one strand of a DNA double helix is the nucleotide sequence ggcataggt what is the sequence for the mRNA strand?

5`... ccagattg ... 3` 3`... ggtctaac ... 5`Remember always A complementarly binds with t with a double bond (hydrogens bonds)(a=t) in the same way g with c by means of 3hydrogen bonds between them.....


How would the following base sequence be coded for in mrna cag tgc acg?

Recall for any DNA sequence, there are actually two sequences because DNA is a double helix composed of two strands. By convention (a thankfully logical convention) we typically record the DNA sequence of the "sense strand" from the 5' end to the 3' end. The sense strand was chosen because the sense DNA sequence is exactly the same as the mRNA sequence except that it has T's where RNA has U's. Thus if the sequence you provided is the sense strand 5'-acagtgc-3', then the mRNA sequence would be 5'-acagugc-3'. However, if what you were asking for is what mRNA sequence would be transcribed from the given DNA sequence, that would depend if you'd given me the sequence 5' to 3' or 3' to 5'. If you've given me the sequence of the antisense strand, 3' to 5' (that is, if you're asking what would happen if an RNA polymerase landed at the left of the sequence and began moving right) the mRNA sequence would be ugucacg. If you've given me the sequence of the antisense strand 5' to 3', then the answer would be gcacugu. I'm sorry if I made this more complicated for you.... I have a feeling you were looking for a simpler answer than this.


If the partial sequence A of rRNA to be detected in environmental engineering system is shown 5'-cggguuagcgcaccgc-3' Design the oligonucleotide probe for the detection of the sequence A only?

8


If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?

The sequence on the strand of the helix is TACCGGATC.