0
Hearing involves sound waves entering the outer ear, traveling through the ear canal to the eardrum, causing it to vibrate. These vibrations are then transmitted through the middle ear bones to the cochlea in the inner ear where they stimulate hair cells to generate neural signals. These signals are then sent to the brain via the auditory nerve for processing and interpretation.
Add your answer:
Earn +20 pts
What is acute hearing?
Acute hearing refers to having exceptionally sensitive or keen hearing capabilities. People with acute hearing are able to detect sounds at low levels or from far distances more easily than the average person.
What is the term that describes the sequence of DNA that a restriction enzyme finds and cuts?
Recognition sequence.
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Is hearing loss in older adults most noticeable?
Yes, hearing loss in older adults is most noticeable due to a gradual decline in hearing ability over time. It may become more pronounced as people experience difficulty in understanding conversations, hearing high-pitched sounds, or hearing in noisy environments. Regular hearing tests and seeking treatment can help manage age-related hearing loss effectively.
At what hearing loss percentage should you get a hearing aid?
It is recommended to consider a hearing aid when your hearing loss reaches a moderate level, which is typically around 40-60 decibels. However, it is best to consult with an audiologist who can assess your hearing loss and recommend the appropriate course of action for your specific needs.
Why would a case go from trial to pretrial?
They wouldn't - you've got the sequence backward. First is the pre-trial hearing, followed by the actual trial itself.
Do students remember a sequence of letters and numbers by hearing it or seeing it?
Everyone is different, but studies show that the average of students remember a sequence of letters and number better with it being read to them than the students reading it themselves. Multiple expiriments have been done on the topic and have shown these results: Students remember better if it has been read to them.
What are some hearing disorders?
Some of the hearing disorders areConductive hearing lossSensorineural hearing lossNoise induced hearing loss
How do bats hearing compare to human hearing?
how does bats hearing compare to human hearing
What are the sequence to be followed to sequence service?
sequence of service
What do you call someone who isn't deaf?
Someone who isn't deaf is typically referred to as hearing, or as having normal hearing.
How do you get the sequence of 3354435543?
3354435543 is a single number, it is not a sequence.3354435543 is a single number, it is not a sequence.3354435543 is a single number, it is not a sequence.3354435543 is a single number, it is not a sequence.
What is a PHP sequence?
There is no such thing. A sequence is a sequence, but it has no special meaning in PHP.
What is a sequence that is predictable?
A deterministic sequence - as opposed to a stochastic or random sequence.
What is markmann hearing?
a hearing about the markmann
What is Irish for hearing?
éisteacht = hearing
What do owls use their hearing for?
hearing
