answersLogoWhite

0


Best Answer

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.

User Avatar

Wiki User

15y ago
This answer is:
User Avatar
More answers
User Avatar

AnswerBot

5mo ago

Codons: AUG - UUC - GUU - AAC - GAC - CAA - AUU - UAA

Anticodons: UAC - AAG - CAA - UUG - CUG - GUU - UAA - AUU

This answer is:
User Avatar

User Avatar

Wiki User

12y ago

Codon: AUG-UUC-GUU-AAC-GAC-CAA-AUU-UAA

Anticodon: UAC-AAG-CAA-UUG-CUG-GUU-UAA-AUU

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Continue Learning about Biology

What are codon and anticodons?

Codon = 3 amino acid sequence found on mRNA. Anti codon = 3 amino acid sequence found on tRNA.The codons are for the traslation of mRNa to an amino acid sequence by using ribosomes.


What is the relationship between codons and anticodons?

Codons are three-nucleotide sequences on mRNA that encode for specific amino acids during protein synthesis. Anticodons are three-nucleotide sequences on tRNA that complementarily base pair with codons on mRNA, allowing the tRNA to deliver the correct amino acid to the ribosome. The interaction between codons and anticodons ensures that the correct amino acids are added to the growing polypeptide chain.


Which two structures contain codons and anticodons?

Codons are found in mRNA molecules, which are involved in protein synthesis during translation. Anticodons, on the other hand, are found in tRNA molecules, which are responsible for carrying amino acids to the ribosome based on the mRNA codons.


Mrna has the following condons agu-ggu-cga what would the anticodons be on tRNA?

The anticodons on tRNA corresponding to the mRNA codons would be UCU-CCA-GCU. This is because they are complimentary to the mRNA codons based on the genetic code.


Do you use mrna codons or trna anticodons for coding chart to tell us what amino acids are coded in dna coding strand?

The mRNA codons are used in the genetic code to specify which amino acids correspond to each three-nucleotide codon. tRNA anticodons complement the mRNA codons during translation to ensure the correct amino acid is added to the growing polypeptide chain. Both mRNA codons and tRNA anticodons play essential roles in protein synthesis.

Related questions

Trna has codons or anticodons?

anti-codons for sure!


Are codons and anticodons found in DNA?

Codons are sequences of three nucleotides found in DNA that code for specific amino acids. Anticodons are complementary sequences found in tRNA that recognize and bind to codons during protein synthesis. So, codons are found in DNA, while anticodons are found in tRNA.


Where do codons and anticodons pair?

In the ribosome


What are codon and anticodons?

Codon = 3 amino acid sequence found on mRNA. Anti codon = 3 amino acid sequence found on tRNA.The codons are for the traslation of mRNa to an amino acid sequence by using ribosomes.


How many anticodons are there?

Well, think about it. There are 64 codons so there must be 64 anticodons


What part do codons and anticodons play in translation?

tRNAanti-codonsact as the interpreters of the mRNA codon sequence


What type of RNA has neither anticodons or codons?

Transfer RNA (tRNA) has anticodons, messenger RNA (mRNA) has codons, and ribosomal RNA (rRNA) plays a structural role in the ribosome. Therefore, regulatory RNA, such as microRNA or small interfering RNA, do not have either anticodons or codons.


Where are codons and anticpdpns found?

Codons are found on messenger RNA, while anticodons are found on transfer RNA


What is the relationship between codons and anticodons?

Codons are three-nucleotide sequences on mRNA that encode for specific amino acids during protein synthesis. Anticodons are three-nucleotide sequences on tRNA that complementarily base pair with codons on mRNA, allowing the tRNA to deliver the correct amino acid to the ribosome. The interaction between codons and anticodons ensures that the correct amino acids are added to the growing polypeptide chain.


What is the purpose of the P site in ribosomes?

Anticodons are attached to the codons on the mRNA.


Are codons found in mRNA or tRNA?

mRNA is made up of anticodons


Which two structures contain codons and anticodons?

Codons are found in mRNA molecules, which are involved in protein synthesis during translation. Anticodons, on the other hand, are found in tRNA molecules, which are responsible for carrying amino acids to the ribosome based on the mRNA codons.