0
Yes, RNA has distinct 5' and 3' ends, similar to DNA. The 5' end refers to the end of the RNA molecule where the phosphate group is attached to the 5' carbon of the sugar molecule, while the 3' end refers to the end where the hydroxyl group is attached to the 3' carbon of the sugar molecule.
Add your answer:
Earn +20 pts
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Is RNA read in the 5-3 or 3-5 direction?
RNA is read in the 5' to 3' direction, meaning that during the process of transcription, nucleotides are added to the growing RNA chain starting from the 5' end and moving towards the 3' end.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
How does RNA move from 3' to 5' during transcription?
During transcription, RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing RNA in the 5' to 3' direction. This process involves the unwinding of the DNA double helix and the addition of nucleotides to the growing RNA strand.
Why does RNA polymerase work in direction 5' to 3' not from 3' to 5'?
RNA polymerase synthesizes RNA in the 5' to 3' direction because it adds nucleotides to the 3' end of the growing RNA chain. This directionality is due to the requirement for a free 3' hydroxyl group on the last nucleotide in the chain for the addition of the new nucleotide.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
Is RNA read in the 5-3 or 3-5 direction?
RNA is read in the 5' to 3' direction, meaning that during the process of transcription, nucleotides are added to the growing RNA chain starting from the 5' end and moving towards the 3' end.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
Why does RNA polymerase work in direction 5' to 3' not from 3' to 5'?
RNA polymerase synthesizes RNA in the 5' to 3' direction because it adds nucleotides to the 3' end of the growing RNA chain. This directionality is due to the requirement for a free 3' hydroxyl group on the last nucleotide in the chain for the addition of the new nucleotide.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
What direction does RNA polymerase move along the DNA?
RNA polymerase moves in the 3' to 5' direction along the DNA template strand during transcription. This allows it to synthesize an RNA molecule in the 5' to 3' direction.
How does RNA polymerase use DNA?
RNA polymerase reads the DNA template and synthesizes a complementary RNA strand by linking together RNA nucleotides according to the base pairing rules. RNA polymerase moves along the DNA strand in the 3' to 5' direction, synthesizing the RNA transcript in the 5' to 3' direction.
Does RNA polymerase read 3 to 5 nucleotides at a time during transcription?
Yes, RNA polymerase reads and adds nucleotides in the 3' to 5' direction during transcription, adding them one at a time to the growing RNA strand.
What is the Product of the distinct prime factors of 150?
The prime factorization of 150 is 2 * 3 * 5^2. The distinct prime factors are 2, 3, and 5. To find the product of these distinct prime factors, you simply multiply them together: 2 * 3 * 5 = 30. Therefore, the product of the distinct prime factors of 150 is 30.
Where does the RNA polymerase moves down?
RNA polymerase catalyze the synthesis of RNA by copying the DNA. It occurs in the 5' to 3' direction(moves down).
Convert the following DNA sequence into its RNA equivalent and then using the genetic code convert that RNA sequence into the amino acid sequence 5tacttcttcaagact-3?
DNA Sequence = 5tacttcttcaagact-3 RNA Sequence = 3'-AUGAAGAAGUUCUGA-5'You just switch 5' and 3'T becomes AA becomes UC becomes GG becomes CThere should be no Ts in an RNA sequence.
What are the distinct prime factors of 75?
3 and 5
