How does DNA determine proteins?

Answer 1

A gene contains the code that determines the structure of a protein.

The order of the nitrogen bases along a gene forms a genetic code that specifies what type of protein will be produced.

Answer 2

Although DNA is double stranded, during transcription the two strands are separated so that a special apparatus can read and transcribe (or copy) the template recipe (ex. ATTCCTTAGGGCTTAGAGGCCGCGTAAA), the copy is called RNA and is single stranded, then uses this copy to translate (decode) it into amino acids. Each amino acid has one or more codes, called codons, consisting of 3bp. (ex. CCT, CCC, CCA, CCG- any one of those codons in DNA will code for Proline)

A protein is made up of a Specific sequence of amino acids. The sequence and variety of amino acids will determine the structures and the function of the protein.

Answer 3

DNA is transcribed (copied) into messenger RNA (mRNA). The messenger RNA undergoes modifications including adding a 5' guanine cap to the 5' end, and then the addition of adenine molecules to form the polyA tail at the 3' end. The mRNA is then undergoes a maturation step where it is 'spliced', and here, the non-coding introns are cut out, and the introns are ligated together. The mature mRNA moves from the nucleus to the cytoplasm where the ribosome binds to it and begins trandslating it. It sequentially adds amino acids to a growing polypeptide chain until a protein is formed.

So in short DNA --> pre mRNA --> mature mRNA --> protein

All credit given to anonymous student

Answer 4

The path from DNA to polypeptide (protein) involves the transcription of mRNA by RNA polymerase and the utilization of mRNA by ribosomes as a template to string together amino acids.

Say, for instance, that a particular gene, minus stops, consists of only nine bases. The nine bases are TATCCTGTT. RNA polymerase reads and transcribes this section of DNA into a corresponding strand of mRNA (this resulting strand of mRNA would read AUAGGACAA). This strand of mRNA is then bound by a ribosome and its nucleobases are matched with their complimentary bases on transfer RNA, or tRNA. The amino acids attached to the ends of tRNA molecules, on the side opposite the anticodons that bind to the mRNA template, combine to form the final product: a polypeptide chain. The sequence for the protein that would result from the example gene would be tyrosine - proline - valine.

Answer 5

The genes in DNA determine the amino acid sequence of proteins. This is the primary structure of a protein, which consequently influences the overall structure of the protein.