0
Yes, RNA has distinct 5' and 3' ends, similar to DNA. The 5' end refers to the end of the RNA molecule where the phosphate group is attached to the 5' carbon of the sugar molecule, while the 3' end refers to the end where the hydroxyl group is attached to the 3' carbon of the sugar molecule.
Add your answer:
Earn +20 pts
Is RNA transcribed in the 5' to 3' direction?
Yes, RNA is transcribed in the 5' to 3' direction.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
In what direction is RNA transcribed?
RNA is transcribed in the 5' to 3' direction.
Is RNA read in the 5-3 or 3-5 direction?
RNA is read in the 5' to 3' direction, meaning that during the process of transcription, nucleotides are added to the growing RNA chain starting from the 5' end and moving towards the 3' end.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
Is RNA transcribed in the 5' to 3' direction?
Yes, RNA is transcribed in the 5' to 3' direction.
In which direction does RNA polymerase read a DNA strand?
The correct answer is: RNA is synthesized by RNA polymerase that reads one strand of DNA. RNA polymerase reads DNA 3' to 5'. When RNA is made, it is made 5' to 3'. Most polymerases have the 3' to 5' "reading" activity. The created RNA strand is identical to the coding strand of DNA, which is also in the orientation of 5' to 3'.
In what direction is RNA transcribed?
RNA is transcribed in the 5' to 3' direction.
Is RNA read in the 5-3 or 3-5 direction?
RNA is read in the 5' to 3' direction, meaning that during the process of transcription, nucleotides are added to the growing RNA chain starting from the 5' end and moving towards the 3' end.
RNA polymerase moves in which direction along the DNA?
RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing a new RNA strand in the 5' to 3' direction.
How does RNA move from 3' to 5' during transcription?
During transcription, RNA polymerase moves along the DNA template strand in the 3' to 5' direction, synthesizing RNA in the 5' to 3' direction. This process involves the unwinding of the DNA double helix and the addition of nucleotides to the growing RNA strand.
What is the significance of the 5 prime and 3 prime ends in DNA replication and transcription?
The 5' and 3' ends of DNA are important in replication and transcription because they determine the direction in which genetic information is read and copied. During replication, the DNA polymerase enzyme can only add new nucleotides to the 3' end of the growing strand, resulting in the synthesis of a new strand in the 5' to 3' direction. In transcription, the RNA polymerase enzyme reads the template DNA strand in the 3' to 5' direction and synthesizes a complementary RNA strand in the 5' to 3' direction. This directional process is crucial for accurately copying and transcribing genetic information.
What is the directionality of RNA synthesis, and how is it related to the concept that RNA is synthesized from 5' to 3' end?
RNA synthesis occurs in a specific direction known as 5' to 3'. This means that RNA is synthesized starting from the 5' end and extending towards the 3' end. This directionality is important for the proper assembly of RNA molecules and is related to the concept that RNA is built in a specific order, similar to reading a book from the beginning to the end.
Why does RNA polymerase work in direction 5' to 3' not from 3' to 5'?
RNA polymerase synthesizes RNA in the 5' to 3' direction because it adds nucleotides to the 3' end of the growing RNA chain. This directionality is due to the requirement for a free 3' hydroxyl group on the last nucleotide in the chain for the addition of the new nucleotide.
What is the directionality of RNA synthesis, and how is it related to the 5' to 3' orientation?
RNA synthesis occurs in a 5' to 3' direction, meaning that nucleotides are added to the growing RNA strand starting from the 5' end and moving towards the 3' end. This directionality is important for the proper assembly of RNA molecules and is essential for the functioning of the genetic code.
What is meant by the 5' and 3' ends of the nucleotide?
The 5' and 3' ends of a nucleotide refer to the carbon atoms in the sugar molecule of the nucleotide. The 5' end has a phosphate group attached to the 5th carbon atom, while the 3' end has a hydroxyl group attached to the 3rd carbon atom. This orientation is important in DNA and RNA molecules for determining the direction in which genetic information is read and synthesized.
Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
